bmp2 4 sc 9003 (Santa Cruz Biotechnology)
Santa Cruz Biotechnology is a verified supplier 
93
Structured Review
Santa Cruz Biotechnology
bmp2 4 sc 9003
Bmp2 4 Sc 9003, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bmp2+sirna/ADPGK+siRNA/pmc12019503__ao4c10642_si_001-17-60-62
Average 93 stars, based on 1 article reviews
Bmp2 4 Sc 9003, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bmp2+sirna/ADPGK+siRNA/pmc12019503__ao4c10642_si_001-17-60-62
Average 93 stars, based on 1 article reviews
bmp2 4 sc 9003 - by Bioz Stars,
2026-09
93/100 stars
Images
Related Articles
Western Blot:Article Title: Notch1 Represses Osteogenic Pathways in Aortic Valve Cells Article Snippet: The cells were transfected with siRNA every 4 days. siRNA (GAGAAAAGCGGCAAGCAAAUU; Dharmacon) against sheep Bmp2 was designed with sequence from the GoSH database. .. To demonstrate the specificity of the Control:Article Title: Palmitate Promotes the Paracrine Effects of Macrophages on Vascular Smooth Muscle Cells: The Role of Bone Morphogenetic Proteins Article Snippet: .. Article Title: SHED-derived conditioned exosomes enhance the osteogenic differentiation of PDLSCs via Wnt and BMP signaling in vitro. Article Snippet: The exosomes from human exfoliated deciduous teeth (SHED-Exos) have exhibited potential therapeutic role in dental and oral disorders.. The biological effects of exosomes largely depend on cellular origin and physiological status of donor cell.. In the present study, we explored the influence of conditioned exosomes from SHED with osteogenic induction on periodontal ligament stem cells (PDLSCs) in vitro. Cell Culture:Article Title: SHED-derived conditioned exosomes enhance the osteogenic differentiation of PDLSCs via Wnt and BMP signaling in vitro. Article Snippet: The exosomes from human exfoliated deciduous teeth (SHED-Exos) have exhibited potential therapeutic role in dental and oral disorders.. The biological effects of exosomes largely depend on cellular origin and physiological status of donor cell.. In the present study, we explored the influence of conditioned exosomes from SHED with osteogenic induction on periodontal ligament stem cells (PDLSCs) in vitro. Transfection:Article Title: SHED-derived conditioned exosomes enhance the osteogenic differentiation of PDLSCs via Wnt and BMP signaling in vitro. Article Snippet: The exosomes from human exfoliated deciduous teeth (SHED-Exos) have exhibited potential therapeutic role in dental and oral disorders.. The biological effects of exosomes largely depend on cellular origin and physiological status of donor cell.. In the present study, we explored the influence of conditioned exosomes from SHED with osteogenic induction on periodontal ligament stem cells (PDLSCs) in vitro. |